Lift

Introduction

An auxiliary feature of splitcode is the ability to modify FASTA files with variants from VCF files, updates GTF annotations to reflect new coordinates, extracts nucleotide windows around variants, and extract nucleotide windows around splice junctions stored in splice junction files (SJ.out.tab files produced by STAR alignment). The feature is called “lift” for the ability to lift variant data onto sequences.

The ability of splitcode to modify FASTA/GTF files with variant data is effectively a re-implementation of most of g2gtools. The ‘bcftools consensus’ command in bcftools also provides the ability modify FASTA files with VCF input.

The ability to extract nucleotide variants surrounding variants facilitates aligning sequencing reads to variant or mutation data.

VCF files

Basic usage

An example use case might be lifting a mouse strain’s SNP and/or indel variants stored in a mouse genome VCF file onto the mouse reference genome and also outputting a GTF file (modified from the mouse reference genome GTF file) accounting for new coordinates after indels have been added in. Let’s say we want to do this for the CAST/EiJ mouse strain (named CAST_EiJ in the VCF file). Given the VCF file (variants.vcf.gz), the reference genome FASTA file (genome.fa.gz), and the reference genome GTF file (genome.gtf), we can do:

splitcode --lift genome.fa.gz variants.vcf.gz CAST_EiJ \
 --rename --ref-gtf genome.gtf --out-gtf output.gtf > output.fasta

The output FASTA sequences were directed into an output.fasta file and the new GTF annotations were written into output.gtf. (We use the –rename option so that each chromosome name in output.fasta file is renamed; each chromosome name will get the prefix “CAST_EIJ_” added to it.)

Diploid mode

VCF files contain genotype information. In the mouse strain example above, we disregarded that (rather, we only retained variant records that were purely homozygous). But, let’s say, we have a hybrid sample (e.g. F1 hybrid) where we want to generate a FASTA file (and optionally, GTF) for each haplotype. We can do this easily by using the --diploid option (the rest of the command follows the same structure as the command above).

The output FASTA file will contain two records for each chromosome (one for each haplotype). The chromosome names will have the suffixes _L and _R appended (e.g. 13_L and 13_R would be the chromosome names for chromosome 13, representing the two haplotypes). The GTF file will likewise have _L and _R appended to the chromosome names.

Nucleotide windows

To extract nucleotide windows around variants, you can use the --kmer-length option to set the “window size”. For example, setting it to 15 defines a sliding window of 15 nucleotides. For a single-nucleotide variant, this results in a total sequence length of 29 nucleotides (14 nucleotides on each side plus the variant itself). The output sequences are written, in FASTA format, to a file defined by the --kmer-output option. An example is shown below:

splitcode --lift genome.fa.gz variants.vcf.gz CAST_EiJ \
 --rename --kmer-length=31 --kmer-output=output_windows.fasta > output.fasta

The output (output_windows.fasta) may look something as follows (the headers are populated with the variant ID and the genomic coordinates of the window):

>rs30883997 1:136213921-136213949
TCTTAAAAATCCACCTTAAGGTTAGTGGG
>rs30883996 1:136213976-136214004
ATTCAAGACAAGGACAAGCCCGAGTGCTT
>rs217644907 1:136213984-136214012
CAAGGATAAGCCCGGGTGCTTAATATCAT
>rs30883994 1:136214034-136214062
GAGACACGAGGCAGCCTTCAATTTTGCTT
>rs30883052 1:136214091-136214119
AACTAAGATGGTCAAAATTTCACTGAGAA

Tip

You can further customize the headers of the output by two additional options. For example, setting --kmer-header=X_ causes X_ to be put in the header in place of the variant ID and, additionally supplying --kmer-header-num will put incremental numbers after the header (e.g. X_0, X_1, X_2, X_3, etc.).

Splice junctions

To extract windows (say, of length 15 nucleotides) around splice junctions of SJ.out.tab files (which is nothing more than tab-separated file where the first three columns are the chromosome, start position, and end position), you can do the following:

splitcode --lift --kmer-sj genome.fa.gz SJ.out.tab --kmer-length=15

Each record in the output FASTA file may look something like the following:

>1:3094999-3096284
CAATATAGTAAAAAATATTATCATCCTG

Usage information

splitcode --lift <ref_fasta> <vcf_file> <sample> [--diploid] [--filter] [--rename] [--snv-only] [--ref-gtf <ref_gtf>] [--out-gtf <out_gtf>]


Options for contig extraction:
    --kmer-length=INT       Length of the k-mers that contain the variant
    --kmer-output=STRING    Filename for k-mer output sequences
    --kmer-header=STRING    The header of the sequences in the FASTA output (default: the variant IDs in the VCF file)
    --kmer-header-num       If specified, will append a number (in increasing numerical order) to each header
    --kmer-sj               Extracts k-mer spanning splice junctions following a given SJ file. See usage below.
                            splitcode --lift --kmer-sj <ref_fasta> <SJ_file> [additional k-mer options]

References

The following references, which either describe the method, were posted prior to, or contributed to the development of this tutorial, are acknowledged and credited:

  1. g2gtools

  2. bcftools

  3. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, Gingeras TR. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013 Jan;29(1):15-21. https://doi.org/10.1093/bioinformatics/bts635